Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.239717 |
Chromosome: | chromosome 12 |
Location: | 4852586 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g525050 | SMC6A | (1 of 2) PTHR19306//PTHR19306:SF6 - STRUCTURAL MAINTENANCE OF CHROMOSOMES 5,6 SMC5, SMC6 // PROTEIN C23H4.6, ISOFORM A-RELATED; Structural Maintenance of Chromosomes protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCCGATACACCATTGCAGGACATGCACA |
Internal bar code: | ATTAGGAGGTTATAGTTATTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 220 |
LEAP-Seq percent confirming: | 99.7797 |
LEAP-Seq n confirming: | 906 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGACTTGAGTCGCCACAAAC |
Suggested primer 2: | AAAACCTCCGCCTCCATACT |