| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.239806 |
| Chromosome: | chromosome 12 |
| Location: | 8186275 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g550800 | REV1 | (1 of 1) K03515 - DNA repair protein REV1 (REV1); Deoxycytidyl transferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCGGGGGTCGGGACCCGAGAGGCATGC |
| Internal bar code: | CATCCGGATGCGTCGTTGGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1427 |
| LEAP-Seq percent confirming: | 79.1667 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAATGCCAACGAAGTTTGG |
| Suggested primer 2: | CTCCTGATGTGGTGTTGGTG |