| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.239839 |
| Chromosome: | chromosome 3 |
| Location: | 4156478 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g173600 | (1 of 11) IPR000626//IPR029071 - Ubiquitin domain // Ubiquitin-related domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCCTTGAACATGGAGGTGCCCACGGGTT |
| Internal bar code: | GTAAAGTAGCCGCACCCGGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 504 |
| LEAP-Seq percent confirming: | 99.8355 |
| LEAP-Seq n confirming: | 607 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACTGTATGGACGGACGCA |
| Suggested primer 2: | GAGGGAGAGGAGGAAGAGGA |