Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.240005 |
Chromosome: | chromosome 10 |
Location: | 584182 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g421650 | paralog of LCI36; (1 of 4) K15382 - solute carrier family 50 (sugar transporter) (SLC50A, SWEET) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAACACTGGGTGCGCGTGTGTCACCATG |
Internal bar code: | TTGCTTGGGGGCGGACTGCCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 408 |
LEAP-Seq percent confirming: | 98.7116 |
LEAP-Seq n confirming: | 996 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCATGAGTCAGCGAGTCACC |
Suggested primer 2: | CTGCGGTGGTACCATCTTTT |