| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.240316 |
| Chromosome: | chromosome 10 |
| Location: | 2540418 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g436800 | (1 of 2) PF01833//PF07691//PF10162 - IPT/TIG domain (TIG) // PA14 domain (PA14) // G8 domain (G8) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCATTTGGATTCCTCAGGTACTCACAATG |
| Internal bar code: | CCTTTTCGTATTGCTACTAATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 184 |
| LEAP-Seq percent confirming: | 99.3797 |
| LEAP-Seq n confirming: | 801 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCACCTACACCTCCCTCG |
| Suggested primer 2: | CTACGCTAGGATGGGAGCAG |