Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.240363 |
Chromosome: | chromosome 10 |
Location: | 5179517 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g456700 | CASC3,EJC1 | (1 of 1) PF09405 - CASC3/Barentsz eIF4AIII binding (Btz); Exon Junction Complex component | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCGTCAGCTACAACGCAAGGTGGGCGGA |
Internal bar code: | GCACGCTAACTCGGCTAACGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 472 |
LEAP-Seq percent confirming: | 97.3684 |
LEAP-Seq n confirming: | 555 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGATGTTTTGTAGGGGCACT |
Suggested primer 2: | TCAATTGCCAAGCTTCACTG |