Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.240378 |
Chromosome: | chromosome 8 |
Location: | 3413129 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g374700 | FAP244 | (1 of 2) PTHR14885:SF1 - WD REPEAT-CONTAINING PROTEIN 96; Flagellar Associated Protein 244 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACGGCAGAGCATCCCCTGCTCGACCTGG |
Internal bar code: | GACGCGCAAAGCACGGGGCCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 631 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 28 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACGTCCATCTGGTTGTC |
Suggested primer 2: | GCCATGCTGCTTTCTAGTCC |