| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.240386 |
| Chromosome: | chromosome 6 |
| Location: | 7484348 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g300250 | TTL10 | (1 of 1) K16600 - tubulin polyglutamylase TTLL2 [EC:6.-.-.-] (TTLL2); Putative tubulin tyrosine ligase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGTGGGGCTCAGTGGGTGAGGGCTGGGT |
| Internal bar code: | GGTACCCGCGTCACCAAAGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5 |
| LEAP-Seq percent confirming: | 78.4038 |
| LEAP-Seq n confirming: | 167 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTCAGAGGAAAAGGAGC |
| Suggested primer 2: | GACCTTATAATCCCGCAGCA |