| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.240392 |
| Chromosome: | chromosome 9 |
| Location: | 6557250 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g408000 | POB22 | (1 of 3) PF03227 - Gamma interferon inducible lysosomal thiol reductase (GILT) (GILT); Proteome of basal body 22 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCACCTCGCCCGTAGCATACATTTTCAC |
| Internal bar code: | GTCGCTGGACCGCGGCATAGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 218 |
| LEAP-Seq percent confirming: | 99.6587 |
| LEAP-Seq n confirming: | 292 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTTATCGGGCTTTAGGCA |
| Suggested primer 2: | GAATTGTGGTTTGTCATGCG |