| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.240432 |
| Chromosome: | chromosome 10 |
| Location: | 5998208 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g462750 | (1 of 1) K11374 - elongator complex protein 2 (ELP2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCCAGGCCAGCTGTGTGACGGTGAGGGT |
| Internal bar code: | GTCCACCTATCGCAGCCTCAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 311 |
| LEAP-Seq percent confirming: | 19.5122 |
| LEAP-Seq n confirming: | 48 |
| LEAP-Seq n nonconfirming: | 198 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGATTTTCCTCTGCCACCTA |
| Suggested primer 2: | CACATTCCCCATTCTTCACC |