Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.240436 |
Chromosome: | scaffold 36 |
Location: | 1941 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre36.g759597 | (1 of 2) IPR001841//IPR013083//IPR024766 - Zinc finger, RING-type // Zinc finger, RING/FYVE/PHD-type // Zinc finger, RING-H2-type | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTGTGCGGTGATGTTCGTCGGTTGTGAC |
Internal bar code: | CCTTGCTGTCAACCGTACGCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 514 |
LEAP-Seq percent confirming: | 98.7179 |
LEAP-Seq n confirming: | 1155 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGACCTTCCATCACACACAC |
Suggested primer 2: | TTTACGGTGCACGATGATGT |