Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.240479 |
Chromosome: | chromosome 1 |
Location: | 7206611 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g051750 | (1 of 6) PTHR24114:SF2 - LEUCINE-RICH REPEAT-CONTAINING PROTEIN 74 | 3'UTR|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCGTGAGGAAATGCGCATCAGCAAACTT |
Internal bar code: | TTGTCATGTCCACGGCCACTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 281 |
LEAP-Seq percent confirming: | 97.4074 |
LEAP-Seq n confirming: | 263 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATAACGCTTATGACACCCGC |
Suggested primer 2: | TTGACATTCAGACAGGCGAG |