| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.240597 |
| Chromosome: | chromosome 2 |
| Location: | 7871102 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g141700 | FAP315 | (1 of 2) PTHR12932//PTHR12932:SF9 - P25 ALPHA-RELATED // TPPP FAMILY PROTEIN CG45057; EF-Hand Containing Flagellar Associated Protein 315 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACGCTCGTGTCATACGACTCCTCTCGTC |
| Internal bar code: | CTCAGATTCGAGCAGTCCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1 |
| LEAP-Seq percent confirming: | 99.801 |
| LEAP-Seq n confirming: | 3511 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTGTTCGCACTCAACAAG |
| Suggested primer 2: | CGGAGGGAGACATCACTCAT |