Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.240714 |
Chromosome: | chromosome 16 |
Location: | 577514 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g692350 | (1 of 10) PTHR23257//PTHR23257:SF520 - SERINE-THREONINE PROTEIN KINASE // IP11267P | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTTGCTTCTGACCACCCCTTCCGTCCGT |
Internal bar code: | TCGTACATGCCGGAGAGCTCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 205 |
LEAP-Seq percent confirming: | 98.4709 |
LEAP-Seq n confirming: | 644 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCGCTACTGCTACTGCTCT |
Suggested primer 2: | CCAGGCCTTCATTACAGCAT |