Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.240716 |
Chromosome: | chromosome 7 |
Location: | 5596611 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g351825 | (1 of 7) 2.7.10.2//2.7.12.1 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Dual-specificity kinase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACAGGAATAACAAGCTAGGTACGACACA |
Internal bar code: | GTATTCAGTGTGAGGATTTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 580 |
LEAP-Seq percent confirming: | 99.2814 |
LEAP-Seq n confirming: | 1796 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGTTTGGTGCTAAATTCGG |
Suggested primer 2: | CGATACAGGCTGTGCTTCAA |