Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.240788 |
Chromosome: | chromosome 10 |
Location: | 2861860 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g439750 | (1 of 6) PTHR24114:SF2 - LEUCINE-RICH REPEAT-CONTAINING PROTEIN 74 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCATGGTCGGGGGCGCAAACGTTAGCA |
Internal bar code: | TAGCCGTGGATCGGTTAGCTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 134 |
LEAP-Seq percent confirming: | 99.3915 |
LEAP-Seq n confirming: | 490 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTCGGTTTCGGTGATTACG |
Suggested primer 2: | CTGTCAGGAGGCGGAAGTAG |