| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.240807 |
| Chromosome: | chromosome 17 |
| Location: | 4322356 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g730950 | KIN2-2,KHP1,FLA10 | Kinesin-II Motor Protein; (1 of 2) K10394 - kinesin family member 3/17 (KIF3_17) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTTCTCCCCCCCCCTTCCTCCTTACGGG |
| Internal bar code: | CGTACGCCGTATCAGCCACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 887 |
| LEAP-Seq percent confirming: | 96.9697 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAGCAGTTAGTTCAGGGC |
| Suggested primer 2: | CACGTATGTACGGCCATCAG |