Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.240875 |
Chromosome: | chromosome 6 |
Location: | 3089568 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g274700 | OTU4 | (1 of 2) K13719 - ubiquitin thioesterase OTU1 (OTU1, YOD1); OTU-like cysteine protease | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGGCGTGTTTGGTTAGCAGTACCCTTA |
Internal bar code: | AGTCGGTTTAGGCAGGGGTCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 619 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 250 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGCCTTCGCTTCCACAGAT |
Suggested primer 2: | TTGGTGATTAGCAGGTCGTG |