Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.240901 |
Chromosome: | chromosome 9 |
Location: | 3562295 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g390023 | CRR1 | Copper responsive regulator 1; (1 of 2) IPR004333//IPR020683 - Transcription factor, SBP-box // Ankyrin repeat-containing domain | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTTGACAAGCTGAACAAAGCGTCGCCGG |
Internal bar code: | TTTAGGAACTCCATTCCGTGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 745 |
LEAP-Seq percent confirming: | 99.6173 |
LEAP-Seq n confirming: | 3644 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGCTTACGGATTACCAACG |
Suggested primer 2: | CCGCTCTGGTCTAAGTACGC |