| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.241016 |
| Chromosome: | chromosome 7 |
| Location: | 5806244 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g353300 | PXN1,MCP22 | Peroxisomal NAD+ carrier; (1 of 2) K13354 - solute carrier family 25 (peroxisomal adenine nucleotide transporter), member 17 (SLC25A17, PMP34) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAATGCGCACATAGTCTGCAGAGGAAGTCG |
| Internal bar code: | TTGCGGGGGTGTATAGTCGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 605 |
| LEAP-Seq percent confirming: | 87.8247 |
| LEAP-Seq n confirming: | 541 |
| LEAP-Seq n nonconfirming: | 75 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAAGATGCTGCAGACGGTG |
| Suggested primer 2: | CTCCTCTATCCTCCACGCTG |