| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.241145 |
| Chromosome: | chromosome 12 |
| Location: | 4451360 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g521400 | (1 of 1) 6.3.5.11 - Cobyrinate a,c-diamide synthase (glutamine-hydrolyzing) / Cobyrinic acid a,c-diamide synthetase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCACTAGCACCGTCATGCTAGAAGCAGC |
| Internal bar code: | CGGACGGTCGAGTGATGACGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 300 |
| LEAP-Seq percent confirming: | 91.7127 |
| LEAP-Seq n confirming: | 166 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTCTGTCACGCACAAGGT |
| Suggested primer 2: | CATCTTGCTGCTGCTCACC |