Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.241258 |
Chromosome: | chromosome 6 |
Location: | 5242331 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g282251 | (1 of 12) IPR000104//IPR002893 - Antifreeze protein, type I // Zinc finger, MYND-type | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCAGTGCGTCGTACCGTGTGTTGTCCTC |
Internal bar code: | TCACACCTGCAACCGCTGGTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 578 |
LEAP-Seq percent confirming: | 98.125 |
LEAP-Seq n confirming: | 1256 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGCGCTTTTCCTCTAGACT |
Suggested primer 2: | GTTAGGGCGAGTCTCAGTCG |