| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.241270 |
| Chromosome: | chromosome 6 |
| Location: | 4282737 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278252 | GOX18,GOX9 | (1 of 12) 1.1.3.9 - Galactose oxidase / Beta-galactose oxidase; Glyoxal oxidase 18 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTCAGTGCCAGTTTCGTGGAGTGCAGTG |
| Internal bar code: | GTAGATACGGTTGGCCGCGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 624 |
| LEAP-Seq percent confirming: | 93.1507 |
| LEAP-Seq n confirming: | 68 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGTGTGTCATGTGGAGCC |
| Suggested primer 2: | GCACCACACACTCCACAAAC |