| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.241340 |
| Chromosome: | chromosome 4 |
| Location: | 3312942 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g227000 | MLH2 | DNA mismatch repair protein; (1 of 1) K10858 - DNA mismatch repair protein PMS2 (PMS2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAATCCGCATCCATAACACGCGTATTAAT |
| Internal bar code: | TGGGGGGGTAGACGGCGAGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 502 |
| LEAP-Seq percent confirming: | 98.5019 |
| LEAP-Seq n confirming: | 263 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGAATAGCGTCTTGAGCCC |
| Suggested primer 2: | CGTCACAGGGGTCGTATCTT |