| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.241383 |
| Chromosome: | chromosome 10 |
| Location: | 154127 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g418800 | DIV156 | (1 of 7) IPR000048//IPR027417 - IQ motif, EF-hand binding site // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACACAGCATGGCCACTCACCGTCTCCGGC |
| Internal bar code: | CGCGTGGCAGAGGGCAAGTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 283 |
| LEAP-Seq percent confirming: | 96.519 |
| LEAP-Seq n confirming: | 305 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTGCATAACTGCTGACGC |
| Suggested primer 2: | AGTGTAACGTCATGCCCCTC |