Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.241553 |
Chromosome: | chromosome 3 |
Location: | 5462941 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g185350 | BGS3,CALS1,GTR9,GTR15 | Callose synthase 1; (1 of 2) K11000 - callose synthase [EC:2.4.1.-] Glc b1-3 Glc (CALS) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCAAACTGTCGTCACGGTATGGCCCCTT |
Internal bar code: | GCGTTGCATGAAGGGGAGGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 261 |
LEAP-Seq percent confirming: | 51.3274 |
LEAP-Seq n confirming: | 174 |
LEAP-Seq n nonconfirming: | 165 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGACATGAACCAAGACAACG |
Suggested primer 2: | AGGATGAGGACGTGATGGAG |