| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.241555 |
| Chromosome: | chromosome 6 |
| Location: | 1567208 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g260400 | FAP287 | (1 of 1) PF13881 - Ubiquitin-2 like Rad60 SUMO-like (Rad60-SLD_2); Ubiquitin-like Flagellar Associated Protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCATCGGAGTTGGGCGGAAGGGCGCAGGC |
| Internal bar code: | ACGGGCATGAGCGTGGAACTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 563 |
| LEAP-Seq percent confirming: | 99.2255 |
| LEAP-Seq n confirming: | 1153 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCTTCGGGTAAGTGGATT |
| Suggested primer 2: | GTTCTACTGCGGAAACGCTC |