| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.241650 |
| Chromosome: | chromosome 1 |
| Location: | 3093929 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g019200 | NOP52,GEX18 | RRP1-like protein; (1 of 1) K14849 - ribosomal RNA-processing protein 1 (RRP1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCCGTGAAGATAGCAAGCGGCGAGACT |
| Internal bar code: | GTATCAGGGAGGTCAAAGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 512 |
| LEAP-Seq percent confirming: | 98.9634 |
| LEAP-Seq n confirming: | 1432 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTCCTCATTCGACAACTT |
| Suggested primer 2: | GACTCCTTGCCGCACTCTAC |