Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.241745 |
Chromosome: | chromosome_11 |
Location: | 1697484 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre11.g467781 | FAP151 | ABC transporter-like and Flagellar Associated Protein | sense | CDS/intron |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | GTGTGCGGGCGCGCGCGTGCGAGGTTCATA |
Internal bar code: | TTTTCGTCCAAATTTCAGCTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 178 |
LEAP-Seq percent confirming: | 94.1646 |
LEAP-Seq n confirming: | 3889 |
LEAP-Seq n nonconfirming: | 241 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTCGGGTTACTCCCAGTTC |
Suggested primer 2: | TTCTCACGTGTGTTGGGGTA |