| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.241766 |
| Chromosome: | chromosome 7 |
| Location: | 4058238 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g340400 | RSP17 | Radial Spoke Protein 17; (1 of 1) IPR000104//IPR029016 - Antifreeze protein, type I // GAF domain-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCACCGCGGCGCGCTTAGCACTGTGTGT |
| Internal bar code: | TCAGCCGAGCATGTTTTCGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 142 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGACCGAGTCGCGTTTTAG |
| Suggested primer 2: | GAGCTGGAAGTAGGCGTTTG |