| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.241788 |
| Chromosome: | chromosome 4 |
| Location: | 2655116 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g223000 | HLM9 | Histone-lysine N-methyltransferase; (1 of 1) PF12234 - RAVE protein 1 C terminal (Rav1p_C) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGCTCATAGCTACTCAAACGCCCTCCA |
| Internal bar code: | CCCCCCGCTGTGGCCATAACAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 82 |
| LEAP-Seq percent confirming: | 98.773 |
| LEAP-Seq n confirming: | 322 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTCTGCTCAGGTCCTTGT |
| Suggested primer 2: | ATTCCCGTGAAACAAACTGC |