| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.241791 |
| Chromosome: | chromosome 12 |
| Location: | 6810872 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g561550 | CDS1 | Mitochondrial half-size ABC transporter, membrane protein; (1 of 2) K05661 - ATP-binding cassette, subfamily B (MDR/TAP), member 6 (ABCB6) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAACTGAGCAAACCCTCTCATGACCATAC |
| Internal bar code: | TCAACATCGGGCCCGTACACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 476 |
| LEAP-Seq percent confirming: | 99.8043 |
| LEAP-Seq n confirming: | 510 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTTGTTGACTCTGATGCC |
| Suggested primer 2: | GACATGACATGGTCTCGTGG |