Insertion junction: LMJ.RY0402.241812_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.241812
Chromosome:chromosome_2
Location:3212805
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre02.g095072 FAP144 Flagellar Associated Protein sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TTTGACTTGGACTTCTGACATTGCATTATT
Internal bar code:TGACGTGGAGTTTTTGGTACCC

Confirmation - LEAP-Seq

LEAP-Seq distance:647
LEAP-Seq percent confirming:98.6741
LEAP-Seq n confirming:3349
LEAP-Seq n nonconfirming:45
LEAP-Seq n unique pos:57

Suggested primers for confirmation by PCR

Suggested primer 1:CCATGTTTGACCACAAGCAC
Suggested primer 2:CTACCTGCCAGCTTCTGTCC