| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.241895 |
| Chromosome: | chromosome 17 |
| Location: | 5984174 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g740510 | DIV23,APC3,CDC27 | Subunit of anaphase-promoting complex; (1 of 1) K03350 - anaphase-promoting complex subunit 3 (APC3, CDC27) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGTTAAGAGGATTGGGCTAGGCAATGCG |
| Internal bar code: | GGCTGCATCAACGACTGCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1196 |
| LEAP-Seq percent confirming: | 99.3208 |
| LEAP-Seq n confirming: | 7896 |
| LEAP-Seq n nonconfirming: | 54 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGAGCCATGGACTCTGTC |
| Suggested primer 2: | GATGCTTCTACTTGCTGCCC |