Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.241917 |
Chromosome: | chromosome_4 |
Location: | 3486881 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre04.g227900 | PF20 | WD-repeat protein of flagellum central pair | sense | intron |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | ACCGGTATGTGTGTTAGCAAAGCACAATGG |
Internal bar code: | TGGTTGTACGAGCTTTCCAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 353 |
LEAP-Seq percent confirming: | 99.5527 |
LEAP-Seq n confirming: | 2448 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGGGGGAGAGAGAGCAGTT |
Suggested primer 2: | ACTCGAGTTTGGAAGAGCCA |