Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.241941 |
Chromosome: | chromosome 16 |
Location: | 6519423 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g672750 | (1 of 2) K14944 - RNA-binding protein Nova (NOVA) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTCTGCGACCCACCCCCGCCCAGGGTAG |
Internal bar code: | GTACATGCTGACGTCAAATTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 811 |
LEAP-Seq percent confirming: | 99.1326 |
LEAP-Seq n confirming: | 2743 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTGTCAACTCTGCAGTGGC |
Suggested primer 2: | AAGTGTTAGGGTGCGTGTCC |