| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.241978 |
| Chromosome: | chromosome 1 |
| Location: | 7457273 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g053500 | (1 of 1) K05956 - geranylgeranyl transferase type-2 subunit beta [EC:2.5.1.60] (RABGGTB) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGCTGCTGGTGGGCGGACGCACGGGGCT |
| Internal bar code: | CGCAGAACAAGGAGGGAACTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 170 |
| LEAP-Seq percent confirming: | 88.3064 |
| LEAP-Seq n confirming: | 219 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCCAACGCTCTTAATTC |
| Suggested primer 2: | ACCAGTACCGCCTGATGAAC |