Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.242068 |
Chromosome: | chromosome 3 |
Location: | 6625547 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g196700 | (1 of 4) PF01679 - Proteolipid membrane potential modulator (Pmp3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCAATTACTACCCTGGTTGAAACTCTG |
Internal bar code: | GCAGGGCGCACCAATTCGCCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 632 |
LEAP-Seq percent confirming: | 98.2987 |
LEAP-Seq n confirming: | 520 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTCGGCGAGCTCTACAAAT |
Suggested primer 2: | CCTACAACCCCAGCAGTGAT |