| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.242111 |
| Chromosome: | chromosome 10 |
| Location: | 2210271 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g433900 | (1 of 2) K10592 - E3 ubiquitin-protein ligase HUWE1 (HUWE1, MULE, ARF-BP1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTACGCAAACACGGGGTGAACTGACTGGC |
| Internal bar code: | GGTGCCTTACGATTAGTATGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 908 |
| LEAP-Seq percent confirming: | 99.2672 |
| LEAP-Seq n confirming: | 31427 |
| LEAP-Seq n nonconfirming: | 232 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCGGAAGTAAGCATTGGTG |
| Suggested primer 2: | TGCAGCTAGACATGGACCAG |