| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.242112 |
| Chromosome: | chromosome 16 |
| Location: | 428347 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g693202 | SIR1 | Ferredoxin-sulfite reductase; (1 of 2) 1.8.7.1 - Assimilatory sulfite reductase (ferredoxin) / Sulfite reductase (ferredoxin) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCAACATAGCATCTTGCTCTTCACCATC |
| Internal bar code: | CGTAGCCGTGGAATTTACGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 595 |
| LEAP-Seq percent confirming: | 99.3137 |
| LEAP-Seq n confirming: | 3039 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCCTTACCTGCCTCTCAC |
| Suggested primer 2: | GCTTGGTGACCTGCTTTCTC |