Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.242126 |
Chromosome: | chromosome 9 |
Location: | 1044242 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g400750 | AMT5,AMT1Ea,AMT1E | Ammonium transporter; (1 of 8) K03320 - ammonium transporter, Amt family (amt, AMT, MEP) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCCCCCTGTGCGCACAGGCCTTTATGC |
Internal bar code: | CAAGTTAGCGCCGGGCCAGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 220 |
LEAP-Seq percent confirming: | 93.2039 |
LEAP-Seq n confirming: | 192 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTTCGTGCCAAGTTTTGTT |
Suggested primer 2: | TTCTTTCCCTAAACCCCACC |