Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.242138 |
Chromosome: | chromosome 12 |
Location: | 6908507 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g560668 | (1 of 9) IPR000719//IPR002290//IPR011009//IPR020635//IPR027916 - Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain // Protein kinase-like domain, Apicomplexa | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCAGCAGCAGCTGCAGACCAGACACCAG |
Internal bar code: | AAGTGAGCCAGATTGTGGGAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 143 |
LEAP-Seq percent confirming: | 65.6716 |
LEAP-Seq n confirming: | 44 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAAGCTCCACGCACTCACAG |
Suggested primer 2: | CACCTCCACATTCCACACAC |