Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.242455 |
Chromosome: | chromosome 3 |
Location: | 7978024 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g201850 | SRH10 | (1 of 2) K10877 - DNA repair and recombination protein RAD54B (RAD54B); SNF2-related DNA/RNA helicase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCTTTTCCGGCCGTGCACTGCGACACT |
Internal bar code: | ATGGGCAACGTGACCACAAAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 344 |
LEAP-Seq percent confirming: | 97.7346 |
LEAP-Seq n confirming: | 302 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCTAAAGGGCAGCACGAAC |
Suggested primer 2: | AGGAGGGTGTTGTCAAGGTG |