Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.242497 |
Chromosome: | chromosome 7 |
Location: | 4536906 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g343700 | OGD2 | Dihydrolipoamide succinyltransferase, oxoglutarate dehydrogenase E2 component; (1 of 2) K00658 - 2-oxoglutarate dehydrogenase E2 component (dihydrolipoamide succinyltransferase) (DLST, sucB) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATGACTCGGGCGCAACACCCCTTCTGCT |
Internal bar code: | TGGATCGCGCTTCAAGGGGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 177 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAAATGCACAGTGTGGTTG |
Suggested primer 2: | TTGTCTCACAGCAGTTTGCC |