| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.242649 |
| Chromosome: | chromosome 13 |
| Location: | 1382038 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g571850 | APC10 | Anaphase promoting complex subunit 10; (1 of 1) K03357 - anaphase-promoting complex subunit 10 (APC10, DOC1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGCGACACTCGTGAGCGGGAAAGGCAGG |
| Internal bar code: | CTCGCACCACGCGTCAACGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 162 |
| LEAP-Seq percent confirming: | 1.78571 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 935 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATACACGCACATCCCTCA |
| Suggested primer 2: | CTACCTCCACATTCCCTCCA |