| Insertion cassette: | CIB1 | 
| Side of cassette: | 5' | 
| Strand: | - | 
| Strain: | LMJ.RY0402.242666 | 
| Chromosome: | chromosome 11 | 
| Location: | 255953 | 
| Confidence (%): | 73 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre11.g467557 | (1 of 2) PTHR31389:SF4 - PROTEIN F32B4.1 | 5'UTR | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCGATTTTGAGGTGGCCAGCAGCAAGA | 
| Internal bar code: | GTGTCCCTTCGTACAAAGGAGA | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 247 | 
| LEAP-Seq percent confirming: | 100.0 | 
| LEAP-Seq n confirming: | 193 | 
| LEAP-Seq n nonconfirming: | 0 | 
| LEAP-Seq n unique pos: | 1 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGTAGAAAGCCAGCCATC | 
| Suggested primer 2: | GACTGGACATTCACACACGG |