| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.242680 |
| Chromosome: | chromosome 15 |
| Location: | 232389 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g638101 | (1 of 1) PF03692 - Putative zinc- or iron-chelating domain (CxxCxxCC) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGCTGGGTTTTTGGCGGACGTACCCTC |
| Internal bar code: | TCGGGCATCAAATGGTGAGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 578 |
| LEAP-Seq percent confirming: | 96.9346 |
| LEAP-Seq n confirming: | 1423 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAATCTGCAATGCTTGACCC |
| Suggested primer 2: | GTCATGGTGTTTGCCTCCTT |