| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.242799 |
| Chromosome: | chromosome 10 |
| Location: | 3832420 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g447300 | DDI1 | DNA-damage inducible protein 1 homolog; (1 of 1) K11885 - DNA damage-inducible protein 1 (DDI1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCGCCAATCGGTGGTAGGACCAAGGCA |
| Internal bar code: | TCAACAGGTTGGCCGCCCATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 599 |
| LEAP-Seq percent confirming: | 98.6245 |
| LEAP-Seq n confirming: | 717 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGAGAGGACAAGCATACC |
| Suggested primer 2: | ACGCTGTCTGGATGCCTAGT |