| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.242896 |
| Chromosome: | chromosome 11 |
| Location: | 2673666 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g476650 | PUL1,PU1 | Pullulanase-type starch debranching enzyme 1; (1 of 1) 3.2.1.142//3.2.1.41 - Limit dextrinase / R-enzyme // Pullulanase / Pullulan 6-glucanohydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGTGGGTGGGTGGCGGGGCGGTAGTTA |
| Internal bar code: | TATGGCAGCTGCCTCCTGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 338 |
| LEAP-Seq percent confirming: | 96.8293 |
| LEAP-Seq n confirming: | 397 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGCTTTTATCCTGTCCCA |
| Suggested primer 2: | CCTGCCTACGACTTCACCTC |