| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.242923 |
| Chromosome: | chromosome 7 |
| Location: | 4163384 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g342450 | SEE3 | Putative splicing endonuclease positive effector; (1 of 3) K10706 - senataxin [EC:3.6.4.-] (SETX, ALS4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAATGATGCAGTGCCAAGCGGCCCGGTCC |
| Internal bar code: | GCAGAGATTCCTCGCGTACGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 169 |
| LEAP-Seq percent confirming: | 99.5192 |
| LEAP-Seq n confirming: | 1449 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAACCATCCATCCCTGGTC |
| Suggested primer 2: | TTAGCCATTACGCTCCCAAC |